ID: 1077116855_1077116861

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1077116855 1077116861
Species Human (GRCh38) Human (GRCh38)
Location 11:889095-889117 11:889117-889139
Sequence CCAGGTCCCTCCAGCCACGTGGA ACCCCACAGCTGCCAGAGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 253} {0: 1, 1: 0, 2: 6, 3: 43, 4: 369}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!