ID: 1077121159_1077121167

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1077121159 1077121167
Species Human (GRCh38) Human (GRCh38)
Location 11:909275-909297 11:909308-909330
Sequence CCTGCATCAAACCGTTTCTTCCC TGACCTTCCCTTGGGCAGAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 118} {0: 1, 1: 0, 2: 1, 3: 30, 4: 310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!