ID: 1077140873_1077140878

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1077140873 1077140878
Species Human (GRCh38) Human (GRCh38)
Location 11:1024334-1024356 11:1024358-1024380
Sequence CCAAGATGCCGCTGCCGCTAACC CGGCCACTGCAGTCCCACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 59} {0: 1, 1: 0, 2: 6, 3: 80, 4: 1784}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!