ID: 1077141284_1077141286

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1077141284 1077141286
Species Human (GRCh38) Human (GRCh38)
Location 11:1026025-1026047 11:1026044-1026066
Sequence CCGTCGAATACGAAGCGCTGGCC GGCCGTCGAAGGTGATGACGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 19} {0: 1, 1: 0, 2: 0, 3: 6, 4: 42}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!