ID: 1077143019_1077143026

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1077143019 1077143026
Species Human (GRCh38) Human (GRCh38)
Location 11:1033160-1033182 11:1033195-1033217
Sequence CCGTTTCCCTGCACACACTCGGC TCCATGGCCCGTGGGGCTCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 220} {0: 1, 1: 0, 2: 1, 3: 8, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!