ID: 1077156396_1077156406

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1077156396 1077156406
Species Human (GRCh38) Human (GRCh38)
Location 11:1093895-1093917 11:1093934-1093956
Sequence CCCAGGTGTGGCCCTGGGTGGCC AGGTTTTCAGTTGCAAAATGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!