|
Left Crispr |
Right Crispr |
| Crispr ID |
1077177795 |
1077177812 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:1198501-1198523
|
11:1198551-1198573
|
| Sequence |
CCCTGGCCTGCCTGGCTCCGGGG |
CACCACAGCACAGCCAGGCCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 4, 3: 53, 4: 582} |
{0: 1, 1: 0, 2: 2, 3: 57, 4: 507} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|