ID: 1077190846_1077190852

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1077190846 1077190852
Species Human (GRCh38) Human (GRCh38)
Location 11:1255482-1255504 11:1255511-1255533
Sequence CCTGGAGGCTTACGCAGAGCTCT CCCGGGGAGTGTGCAGTGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 103} {0: 1, 1: 0, 2: 0, 3: 6, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!