ID: 1077195514_1077195519

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1077195514 1077195519
Species Human (GRCh38) Human (GRCh38)
Location 11:1278004-1278026 11:1278044-1278066
Sequence CCCCATGTCTGATGCGGGAGGAC ATCGAGCAGGAGACGCACGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 3, 4: 74} {0: 1, 1: 0, 2: 0, 3: 3, 4: 59}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!