ID: 1077195625_1077195633

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1077195625 1077195633
Species Human (GRCh38) Human (GRCh38)
Location 11:1278648-1278670 11:1278671-1278693
Sequence CCACCTTTCCTCCACACCCACAC CTGCCTCTTGTCCTGGCCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 148, 4: 1044} {0: 1, 1: 0, 2: 4, 3: 34, 4: 333}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!