ID: 1077196087_1077196092

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1077196087 1077196092
Species Human (GRCh38) Human (GRCh38)
Location 11:1280872-1280894 11:1280896-1280918
Sequence CCAGGGACAGCTGAAGGGACAGT CAGGCAGGGCTGAGGCCCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 249} {0: 1, 1: 0, 2: 13, 3: 107, 4: 735}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!