ID: 1077213577_1077213583

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1077213577 1077213583
Species Human (GRCh38) Human (GRCh38)
Location 11:1384606-1384628 11:1384655-1384677
Sequence CCCCTCTGCCTTCTGTAGCTACA AAATAGAATCATACAGCACATGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 11, 3: 135, 4: 769}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!