ID: 1077216426_1077216430

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1077216426 1077216430
Species Human (GRCh38) Human (GRCh38)
Location 11:1397052-1397074 11:1397066-1397088
Sequence CCTCTGTGCTGCCCTGTGCTCTG TGTGCTCTGCAGGAAGTTAACGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 9, 3: 64, 4: 531} {0: 1, 1: 0, 2: 3, 3: 13, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!