ID: 1077219963_1077219975

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1077219963 1077219975
Species Human (GRCh38) Human (GRCh38)
Location 11:1411462-1411484 11:1411489-1411511
Sequence CCTTCCTCCCTCTGCTCCCCAAG CCCAGGTCTGGCCCAGCGGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 187, 4: 1512} {0: 1, 1: 0, 2: 3, 3: 26, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!