ID: 1077220284_1077220297

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1077220284 1077220297
Species Human (GRCh38) Human (GRCh38)
Location 11:1412730-1412752 11:1412774-1412796
Sequence CCCAGAGGGGATCCTCCTGCCTG CTGGCTGCACAGATCAACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 300} {0: 1, 1: 0, 2: 1, 3: 27, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!