ID: 1077225376_1077225386

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1077225376 1077225386
Species Human (GRCh38) Human (GRCh38)
Location 11:1437110-1437132 11:1437148-1437170
Sequence CCTGGCAGAGAGATCCAGTGCGG AGTCCCATGCTGAATTTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 123} {0: 1, 1: 0, 2: 1, 3: 23, 4: 285}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!