ID: 1077231843_1077231853

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1077231843 1077231853
Species Human (GRCh38) Human (GRCh38)
Location 11:1461254-1461276 11:1461293-1461315
Sequence CCCCTGGTGGGCAACGTAGCCAC CACCGCCTCCACGCCGCACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 67} {0: 1, 1: 0, 2: 0, 3: 17, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!