ID: 1077251380_1077251395

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1077251380 1077251395
Species Human (GRCh38) Human (GRCh38)
Location 11:1562169-1562191 11:1562208-1562230
Sequence CCAGTGCTGGGTGAGGGCCCCAG ACTCTGGCCTCGAGGGAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 41, 4: 384} {0: 1, 1: 0, 2: 0, 3: 10, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!