ID: 1077251532_1077251541

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1077251532 1077251541
Species Human (GRCh38) Human (GRCh38)
Location 11:1562981-1563003 11:1563016-1563038
Sequence CCACAGTCGCCCTCAGGCTGGGT TTCCACTGGATGCAGGGCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 146} {0: 1, 1: 0, 2: 1, 3: 22, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!