|
Left Crispr |
Right Crispr |
| Crispr ID |
1077262560 |
1077262568 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:1630484-1630506
|
11:1630534-1630556
|
| Sequence |
CCAGCTGCTACAAGCCCTGCTGC |
TGCTGCCAGTGTAAGATCTGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 9, 2: 21, 3: 60, 4: 400} |
{0: 6, 1: 2, 2: 2, 3: 3, 4: 144} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|