ID: 1077268767_1077268780

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1077268767 1077268780
Species Human (GRCh38) Human (GRCh38)
Location 11:1665513-1665535 11:1665559-1665581
Sequence CCCAGGTGTCAGGCTTGGCAGGA GCAGGTAGCGTGGCTGCCGGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!