ID: 1077273690_1077273710

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1077273690 1077273710
Species Human (GRCh38) Human (GRCh38)
Location 11:1693665-1693687 11:1693707-1693729
Sequence CCCCCCTCTTTGCCCCCAGTGGC CCACCTAGAGCCTGGGGACCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 25, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!