ID: 1077278894_1077278900

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1077278894 1077278900
Species Human (GRCh38) Human (GRCh38)
Location 11:1733082-1733104 11:1733096-1733118
Sequence CCTCTTCCAGCCCAGGCTTGTCC GGCTTGTCCAGGAAGCCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 32, 4: 387} {0: 1, 1: 0, 2: 1, 3: 20, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!