ID: 1077279271_1077279283

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1077279271 1077279283
Species Human (GRCh38) Human (GRCh38)
Location 11:1734750-1734772 11:1734790-1734812
Sequence CCTCCAGACTTCTCCAGGCCCTG AAGGCTGGGCTGGAGCTGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 412} {0: 1, 1: 0, 2: 8, 3: 64, 4: 643}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!