ID: 1077282682_1077282693

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1077282682 1077282693
Species Human (GRCh38) Human (GRCh38)
Location 11:1752786-1752808 11:1752831-1752853
Sequence CCATGTCAGCTGGGGCTCTCAGC GGTCAGCTGCAGAGGAAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 15, 4: 221} {0: 1, 1: 0, 2: 12, 3: 55, 4: 476}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!