ID: 1077302916_1077302923

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1077302916 1077302923
Species Human (GRCh38) Human (GRCh38)
Location 11:1855417-1855439 11:1855446-1855468
Sequence CCCTCAACACTAGGTCCAGGGCA GCCCCTCCAGCTGGACAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 111} {0: 1, 1: 0, 2: 1, 3: 19, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!