ID: 1077306348_1077306357

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1077306348 1077306357
Species Human (GRCh38) Human (GRCh38)
Location 11:1870326-1870348 11:1870355-1870377
Sequence CCGCAGCACCCGGGGACATACAC GTCTCCTGGGAAAGAAGTGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 113} {0: 1, 1: 0, 2: 2, 3: 27, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!