ID: 1077306714_1077306724

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1077306714 1077306724
Species Human (GRCh38) Human (GRCh38)
Location 11:1871868-1871890 11:1871903-1871925
Sequence CCTGGCGCACGCTGGTAGAGTTG CTGGCGTGGGCACTTTTGGGAGG
Strand - +
Off-target summary {0: 2, 1: 4, 2: 1, 3: 13, 4: 73} {0: 3, 1: 2, 2: 0, 3: 10, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!