ID: 1077307674_1077307686

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1077307674 1077307686
Species Human (GRCh38) Human (GRCh38)
Location 11:1875260-1875282 11:1875312-1875334
Sequence CCGATGTCCAAGTCCAGGCGCTG CTGTGCAGCAGAGGCCCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 151} {0: 1, 1: 0, 2: 9, 3: 31, 4: 325}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!