ID: 1077316883_1077316894

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1077316883 1077316894
Species Human (GRCh38) Human (GRCh38)
Location 11:1923346-1923368 11:1923386-1923408
Sequence CCCGAGCCCCCCAAAAGCCACCA GCCTTCCCCAGCGCCTCCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 306} {0: 1, 1: 0, 2: 2, 3: 45, 4: 322}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!