ID: 1077316883_1077316900

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1077316883 1077316900
Species Human (GRCh38) Human (GRCh38)
Location 11:1923346-1923368 11:1923394-1923416
Sequence CCCGAGCCCCCCAAAAGCCACCA CAGCGCCTCCTCAGGGCCCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 306} {0: 1, 1: 1, 2: 5, 3: 24, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!