ID: 1077317994_1077318002

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1077317994 1077318002
Species Human (GRCh38) Human (GRCh38)
Location 11:1927799-1927821 11:1927824-1927846
Sequence CCACGCACTGCGTCCAGCAAAAC CTAAGTCAGGGAGGCCAGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 75} {0: 1, 1: 0, 2: 2, 3: 46, 4: 399}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!