ID: 1077322437_1077322444

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1077322437 1077322444
Species Human (GRCh38) Human (GRCh38)
Location 11:1948272-1948294 11:1948299-1948321
Sequence CCTGACCTTGGGGAACACCCAGC AGGAAGAAAAGGTCTGAGTGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 27, 4: 299} {0: 2, 1: 0, 2: 2, 3: 46, 4: 616}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!