ID: 1077323533_1077323542

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1077323533 1077323542
Species Human (GRCh38) Human (GRCh38)
Location 11:1953358-1953380 11:1953407-1953429
Sequence CCACGTACTTGTTAGGGCTCAGC TACGTATCCTGGGGGGCTCTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 2, 4: 71} {0: 2, 1: 0, 2: 0, 3: 2, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!