ID: 1077324690_1077324698

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1077324690 1077324698
Species Human (GRCh38) Human (GRCh38)
Location 11:1958687-1958709 11:1958700-1958722
Sequence CCCCCATGTCTCCCACAGGCCTC CACAGGCCTCCCTGCCAGGGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 6, 3: 45, 4: 422} {0: 2, 1: 0, 2: 3, 3: 58, 4: 400}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!