ID: 1077324690_1077324701

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1077324690 1077324701
Species Human (GRCh38) Human (GRCh38)
Location 11:1958687-1958709 11:1958708-1958730
Sequence CCCCCATGTCTCCCACAGGCCTC TCCCTGCCAGGGAGGAGAAAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 6, 3: 45, 4: 422} {0: 2, 1: 1, 2: 5, 3: 65, 4: 481}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!