ID: 1077332921_1077332935

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1077332921 1077332935
Species Human (GRCh38) Human (GRCh38)
Location 11:1991219-1991241 11:1991255-1991277
Sequence CCTCTGCGAGAGCAGCCCCTTCC TGCAGGTGGGCTTCCAGGAAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 17, 4: 238} {0: 2, 1: 1, 2: 3, 3: 26, 4: 284}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!