ID: 1077332923_1077332945

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1077332923 1077332945
Species Human (GRCh38) Human (GRCh38)
Location 11:1991234-1991256 11:1991287-1991309
Sequence CCCCTTCCCAGCAAGCCGGCCTG GGCTTCCCTCAGCCCTGGAAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 31, 4: 526} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!