ID: 1077332928_1077332934

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1077332928 1077332934
Species Human (GRCh38) Human (GRCh38)
Location 11:1991241-1991263 11:1991254-1991276
Sequence CCAGCAAGCCGGCCTGCAGGTGG CTGCAGGTGGGCTTCCAGGAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 16, 4: 173} {0: 2, 1: 1, 2: 0, 3: 39, 4: 330}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!