ID: 1077332933_1077332945

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1077332933 1077332945
Species Human (GRCh38) Human (GRCh38)
Location 11:1991253-1991275 11:1991287-1991309
Sequence CCTGCAGGTGGGCTTCCAGGAAG GGCTTCCCTCAGCCCTGGAAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 37, 4: 261} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!