ID: 1077333105_1077333114

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1077333105 1077333114
Species Human (GRCh38) Human (GRCh38)
Location 11:1991992-1992014 11:1992015-1992037
Sequence CCAGCTGCCCCTAATCCCTGCCT GAAAACGTGCTCCTGGGTCACGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 41, 4: 426} {0: 2, 1: 0, 2: 0, 3: 8, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!