ID: 1077353837_1077353849

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1077353837 1077353849
Species Human (GRCh38) Human (GRCh38)
Location 11:2105593-2105615 11:2105622-2105644
Sequence CCCTGTCCCATCTGTCTCTGCCC AACACCAAGTTGGGGCTGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 67, 4: 621} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!