ID: 1077363633_1077363646

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1077363633 1077363646
Species Human (GRCh38) Human (GRCh38)
Location 11:2152395-2152417 11:2152445-2152467
Sequence CCCGAGGGGCTGGCAGGGCCAAG TGCTTGGAGGACGGATGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 59, 4: 421} {0: 1, 1: 0, 2: 0, 3: 12, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!