ID: 1077364868_1077364875

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1077364868 1077364875
Species Human (GRCh38) Human (GRCh38)
Location 11:2157565-2157587 11:2157589-2157611
Sequence CCCGCCAGGGCATCTGGGGACCG CACCCAAGGTGGTGCCTGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 178} {0: 1, 1: 0, 2: 0, 3: 11, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!