ID: 1077367688_1077367693

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1077367688 1077367693
Species Human (GRCh38) Human (GRCh38)
Location 11:2167727-2167749 11:2167754-2167776
Sequence CCTGGAGCAGAGCTGCCTGGCAG CACTGATGCTGGTGACAAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 74, 4: 541} {0: 1, 1: 0, 2: 2, 3: 21, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!