ID: 1077372751_1077372765

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1077372751 1077372765
Species Human (GRCh38) Human (GRCh38)
Location 11:2191176-2191198 11:2191223-2191245
Sequence CCCAGGGCACCTGCCTGGCGGGA CAGGTGGCTGAGATTGCAGAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!