ID: 1077386086_1077386098

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1077386086 1077386098
Species Human (GRCh38) Human (GRCh38)
Location 11:2270193-2270215 11:2270235-2270257
Sequence CCTCCGGTCTCTGCGGTGGCCGG CGCAACAGTTCCGGGGACGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 67} {0: 1, 1: 0, 2: 0, 3: 2, 4: 34}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!