ID: 1077386088_1077386095

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1077386088 1077386095
Species Human (GRCh38) Human (GRCh38)
Location 11:2270196-2270218 11:2270227-2270249
Sequence CCGGTCTCTGCGGTGGCCGGTCG GGCTGCAGCGCAACAGTTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 45} {0: 1, 1: 0, 2: 0, 3: 10, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!