ID: 1077386090_1077386101

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1077386090 1077386101
Species Human (GRCh38) Human (GRCh38)
Location 11:2270212-2270234 11:2270246-2270268
Sequence CCGGTCGCCGCCGCCGGCTGCAG CGGGGACGCGGGTCTCCGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 207} {0: 1, 1: 0, 2: 1, 3: 7, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!