ID: 1077392132_1077392142

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1077392132 1077392142
Species Human (GRCh38) Human (GRCh38)
Location 11:2304982-2305004 11:2305035-2305057
Sequence CCATGAGGAGCTTGTGCTGGGGG GACCACTCTGGGGGTCCCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 344} {0: 1, 1: 0, 2: 2, 3: 18, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!